Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone G056D09
Clone ID G056D09
Vector U3CEO
Project ggtc

Sequence tag G056D09
Sequence
CCATTTNNNCAGCACCTCAAAGACAAAGATGTCGCGTTTTCGCCAGCCACTATTGAAGAAGAACTTATAAAGTTTTGCCG
TGAAGCAAGAGGCAAAGAGAATCGGTTGTGCTACTACATTGGAGCCACAGATGATGCTGCCACCAAGATCATCAATGAGG
TGTCGAAGCCCCTGGCCCACCATATCCCTGTGGAAAAGATCTGTGAGAAGCTGAAGAAGAAAGACAGCCAGATCTGTAAT
CTTAAAATACG
Sequence Type mRNA
Unitrap ID UNI467

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 106792492..106793507 136
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000032575 (Armet) NM_029103 arginine-rich, mutated in early stage tumors Gene [Source:MGI Symbol;Acc:MGI:1922090]

 
Come back to gene ENSMUSG00000032575


For any suggestions or comments, please send an email to unitrap@crg.es