Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14526F8
Clone ID IST14526F8
Vector VICTR74
Project tigm

Sequence tag IST14526F8BBF1
Sequence
GTTTTGTTTTGTTTTTTTCCNAGACAGGGTTTCTCTGTGTAGCCCTGGCTGTCCTGTAACTCACTTTGTAGACCAGGCTG
GCCTCGAACTCAGAAATCCGCCTGCCTCTGCCTCTGCCTCCCAAGTGCTGGGATC
Sequence Type genomic DNA
Unitrap ID UNI14633

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 148334303..148334437 133
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000025495 (Ptdss2) NM_013782 phosphatidylserine synthase 2 Gene [Source:MGI Symbol;Acc:MGI:1351664]


Sequence tag IST14526F8HMR1
Sequence
AAAACAAAAATAAATCTTTAAAAAAGAAAAGAAAGAGAAGAACAAAGTGTGGAAGATTGCCATGGCCN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 148334241..148334307 67
NO GENE  


Sequence tag IST14526F8HMF2
Sequence
GTTTTGTTTTGTTTTTTNNNNNNCAGGGTTTCTCTGTGTAGCCCTGGCTGTCCTGTAACTCACTTTGTANACNAGGCTGG
CCTCGAACTCAGAAATCCGCCTGCCTCTGCCTCTGCCTCCCAAGTGCTGGGATCCAAGGCATGCGACACTACACCCGGTG
ATTTATCTGTTTNATACAAGTACACTGTTGCTGTCTTCACACACCAGAAGANGGCATCGGATTCNACAACAGATGGTTGT
GAGCCACCATGTGGTTGCTGGGANTTNAACTCNNNATCTCTANAANANCANTCANTGCTCTTAACNNCTGAGCCACTTTT
CCAGCCCCTGTTCTTCTCTCTNATGANTGCCCCGTGTCANCTNANCTCCTGCATTTCCAANTGAANGCTANACTCNCNTT
CTGGCTATGTAANANANCTGGTNAGGTTTCNNTTNNNTNGTTNGNAATGCN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser

 
Come back to gene ENSMUSG00000025495


For any suggestions or comments, please send an email to unitrap@crg.es