Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST15079C5
Clone ID IST15079C5
Vector VICTR80
Project tigm

Sequence tag IST15079C5HMR1
Sequence
TTACCAAGTAGCTCANGCTGGCCTCCGACTCGGCTCTCCTGCCTGAGCCTCCTGAGTGTCAGGATTGTAGGCGTGCACCA
TGATGCCTGGCTGGGAAGGAANATTTGTCAGTTTGAAATGGAGGGGAGTANTGTCAAAAAAGAGGGTGCTTGTCTGAATT
GANGGGCCTGGGGAGAGCCTGTTC
Sequence Type genomic DNA
Unitrap ID UNI1307

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 46760481..46760663 175
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000023972 (Ptk7) NM_175168 PTK7 protein tyrosine kinase 7 Gene [Source:MGI Symbol;Acc:MGI:1918711]


Sequence tag IST15079C5HMF2
Sequence
GTTAAGAACACTGACTGCTCTTCCAGAGGTCCTGAGTTCAGTTCCCAGCAGCCACATGGTGGCTCACAGCCATCTGTAGT
GAGATCCAATGCCCTCTTACTTCTGTAAGTATAGCTACAGTGTACTCACATATAATAAAATCTTTTTTAAAAATTAAAAG
GATTCCTCATGTTTGATAAAGGTGTGAATACAAATTCATGTANATACAGAAAAACATGATACTCTCCCTGAAGCTACACA
GTAAATAACAAAAGTGATGTTAAATTCTAGGTTGGGTCAAACCCAAAATGGGTGTTCTTGGTCATTCCAAATGTGTCTTC
TCACCAATGGTTTGGAGCTANAAAGGCTTTTGAGAAAAAAAAN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 15: 100093383..100093744 358
NO GENE  


Sequence tag IST15079C5BBF1
Sequence
GTTAAGAACACTGACTGCTCTTCCANAGGTCCTGAGTTCANTTCCCAGCAGCCACATGGTGGCTCACAGCCATCTGTANT
GAGATCCAATGCCCTCTTACTTCTGTAAGTATAGCTACAGTGTACTCACATATAATAAAATCTTTTTTAAAAATTAAAAG
GATTCCTCATGTTTGATAAAGGTGTGAATACAAATTCATGTAGATACAGAAAAACATGATACTCTCCCTGAAGCTACACA
GTAAATAACAAAAGTGATGTTAAATTCTAGGTTGGGTCAAACCCAAAATGGGTGTTCTTGGTCATTCCNAATGTGTCTTC
TCACCAATGGTTTGGAGCTAGAAAGGCTTTTGANAAAN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 15: 100093383..100093739 347
NO GENE  

 
Come back to gene ENSMUSG00000023972


For any suggestions or comments, please send an email to unitrap@crg.es