Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone G056E11
Clone ID G056E11
Vector U3CEO
Project ggtc

Sequence tag G056E11
Sequence
AGTCNNNATGGGGACTTCCTCAGGTATCATTACAATGGCACACTTCTGGACGGCACGCTCTTTGACTCCAGCTATTCACG
GAACCACACCTTTGACACATACATTGGGCAGGGCTATGTGATTCCTGGGATGGATGAAGGCTCTACTAGGTGTGTGCATT
GGGGAGAGGCGAAGGATTGTGAGTCCCGCCCATCACCTGGGCTTACGGATTATTATTGGCAGAAGGTGCCGC
Sequence Type mRNA
Unitrap ID UNI11096

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 6: 56806354..56810782 114
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000029781 (Fkbp9) NM_012056 FK506 binding protein 9 Gene [Source:MGI (curated);Acc:Fkbp9-001]

 
Come back to gene ENSMUSG00000029781


For any suggestions or comments, please send an email to unitrap@crg.es