Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone CH0195
Clone ID CH0195
Vector pGT0lxr
Project sanger

Sequence tag CH0195
Sequence
AGGCGCAGAAGCAGCTGCTGGAACATCGACGAGAGCAGGAGAGGGAGCAGCTGCTGTGCGAGGGCCGCCGTGAGAAGGCT
GCAGACCCTGCCATGGAGCTGCGACTCAAGCAGCCTAGTGAAGTGGAGCTGGAGGAGTACTACCCGGCCTTCCTGGACAT
GGTGCGGAGCCTGCTAGAGGGGAGCATCGACCCCACACAGTATGAGGACACTCTCCGTGAGATGTTCACCATCCATGCCT
ACATTGGCTTCACTATGGACAAGCTAGTGCAGAACATTGCCCGCCAGCTACACCATCTGGTGAGTGACGACGTATGTCTG
AAGGTGGTAGAGCTGTACCTGAATGAGCAGCAGCGAGGGGCAGCGGGGGGAAACCTGTCCTCCAGATGTGTTCGTGCAGC
ACGGGAGACTAGCTATCAGTGGAAGGCGGAGCGCTGCATGGCAGATGAGAACTGCTTCAAGGTAATGTTCCTGCAGCGCA
GAGGTCAGGTGATCATGACCATAGAGCTCCTGGACACAGAAGAGGCACAGACTGAGGACCCTGTGGAG
Sequence Type mRNA
Unitrap ID UNI1420

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 75274051..75277530 181
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000031622 (Sin3b) NP_033214 transcriptional regulator, SIN3B (yeast) Gene [Source:MGI Symbol;Acc:MGI:107158]

 
Come back to gene ENSMUSG00000031622


For any suggestions or comments, please send an email to unitrap@crg.es