Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST12503D12
Clone ID IST12503D12
Vector VICTR76
Project tigm

Sequence tag IST12503D12HMF1
Sequence
ACACAAGATACTTTCATTTTTCTACGTCCTCTAAGAGAAGCCCTGTCGGTGAGTCATGAGTTTCTTCCATGCTAACCTTG
TTAACG
Sequence Type genomic DNA
Unitrap ID UNI23167

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 117857143..117857227 85
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000017715 (Pgs1) NM_133757 phosphatidylglycerophosphate synthase 1 Gene [Source:MGI (curated);Acc:Pgs1-001]

 
Come back to gene ENSMUSG00000017715


For any suggestions or comments, please send an email to unitrap@crg.es