Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST11150A12
Clone ID IST11150A12
Vector VICTR76
Project tigm

Sequence tag IST11150A12HMF1
Sequence
CCAGGAAGTGAGAGTAACTTGCAACTTGCCAGGTCTGGGGGTGGGGGAGGGGCGGTAAAAGCGTTANCCTCTCCCTTTAC
TAACTTATTACCTTTGGGCAAATGCCTCCACACCACTGAGTCCCTTCATAAAATGGGGTANCAACCCTCTCTTGGCTTCC
TCCTCANACCCTGGTGACCCCGTTGGACCTTGCCTGGATTATCANTCAATCCTNACCCATTCTCCAGTCTTTCCCTAACC
CTAACCCGCCTTTCTNTAAGCTTCTAGTACTTTGAGTTTGTATTGTGCAATCTATTCAGCTCTGTTGGGGTTTGCCTACT
GTGTAATCTCCCTGTGGAACGCCATCAA
Sequence Type genomic DNA
Unitrap ID UNI12825

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 99324287..99324623 325
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000032470 (Mras) NM_008624 muscle and microspikes RAS Gene [Source:MGI (curated);Acc:Mras-001]

 
Come back to gene ENSMUSG00000032470


For any suggestions or comments, please send an email to unitrap@crg.es