Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14294A10
Clone ID IST14294A10
Vector VICTR74
Project tigm

Sequence tag IST14294A10HMF1
Sequence
GGGCTACACAGAGAAATCCTGTCTCGAAAAACC
Sequence Type genomic DNA
Unitrap ID UNI8582 UNI20882 UNI30866 UNI31525 UNI31526 UNI31527 UNI31528

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 1: 13383019..13383051 33
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 10: 26512787..26512819 33
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 6342321..6342353 33
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000041126 (H2afv) H2A histone family, member V Gene [Source:MGI (curated);Acc:H2afv-001]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 12: 3398300..3398332 33
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000020668 (Kif3c) NM_008445 kinesin family member 3C Gene [Source:MGI Symbol;Acc:MGI:107979]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 13: 44775233..44775265 33
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 14: 26524382..26524414 33
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 15: 53146692..53146724 33
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000061731 (Ext1) NM_010162 exostoses (multiple) 1 Gene [Source:MGI (curated);Acc:Ext1-001]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 16: 17459560..17459592 33
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 15122192..15122224 33
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000079709 (AC182749.2-203) NP_001116842 Putative uncharacterized protein [Source:UniProtKB/TrEMBL;Acc:Q8C5D3]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 18: 7376626..7376658 33
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000057440 (Mpp7) NP_001074756 membrane protein, palmitoylated 7 (MAGUK p55 subfamily member 7) Gene [Source:MGI Symbol;Acc:MGI:1922989]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 19: 5618241..5618273 33
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 29045440..29045472 33
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 51446204..51446236 33
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 21668333..21668365 33
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000028252 (Ccnc) NM_016746 cyclin C Gene [Source:MGI (curated);Acc:Ccnc-008]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 43518501..43518533 33
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 6: 10414524..10414556 33
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 6901391..6901423 33
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000051527 (Usp29) NM_021323 ubiquitin specific peptidase 29 Gene [Source:MGI Symbol;Acc:MGI:1888998]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 47257374..47257406 33
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 48854849..48854881 33
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr NT_112000: 57342..57374 33
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr X: 82268405..82268437 33
NO GENE  

 
Come back to gene ENSMUSG00000051527


For any suggestions or comments, please send an email to unitrap@crg.es