Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone G054F08
Clone ID G054F08
Vector U3CEO
Project ggtc

Sequence tag G054F08
Sequence
TTTAGAGCAGAGGTGAAGGAAGAACCCATGGGACTCCCAAGGCGGCTGCTGCTGCTGCTGTTGCTGGCGACTACCTGTGT
CCCAGCCTCCCAGGGCCTGCAGTGCATGCAGTGTGAGAGTAACCAGAGCTGCCTGGTAGAGGAGTGTGCTCTGGGCCAGG
ACCTCTGCAGGACTACCGTGCTTCGGGAATGGCAAGATGATAGAGAGCTGGAGGTGGTGACAAGAGGCTGTGCCCACAGC
GAAAAGACCAACAGGACCATGAGTTACCGCATGGGCTCCATGATCATCAGCCTGACAGAGACCGTGTGCGCCACAAACCT
CTGCAACAGGCCCAGACCCG
Sequence Type mRNA
Unitrap ID UNI11098

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 25247504..25251837 146
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000046223 (Plaur) NM_011113 plasminogen activator, urokinase receptor Gene [Source:MGI Symbol;Acc:MGI:97612]

 
Come back to gene ENSMUSG00000046223


For any suggestions or comments, please send an email to unitrap@crg.es