Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone G054E07
Clone ID G054E07
Vector U3CEO
Project ggtc

Sequence tag G054E07
Sequence
ATAAACAAAACCCACCCGCCCTAACAAATATGAGGCTGCTGGAGAGGGCGAGGAAAGAATGGTTCATGGTCGGGATAGTG
GTGGCGATCGGCGCCGGTAAGCTCGAGCCGTCGGTAGGAGTGAACGGGG
Sequence Type mRNA
Unitrap ID UNI11100

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 81033445..81033573 125
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000031684 (Slc10a7) NM_029736 solute carrier family 10 (sodium/bile acid cotransporter family), member 7 Gene [Source:MGI Symbol;Acc:MGI:1924025]

 
Come back to gene ENSMUSG00000031684


For any suggestions or comments, please send an email to unitrap@crg.es