Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST13411H2
Clone ID IST13411H2
Vector VICTR74
Project tigm

Sequence tag IST13411H2HMF1
Sequence
GCAGGAGGTAGTTTAATCTCGGGTTTTAATTTGTTTTTAATGAAAATAGTTC
Sequence Type genomic DNA
Unitrap ID UNI29812

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 93239259..93239309 51
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000029381 (Shroom3) NM_001077595 shroom family member 3 Gene [Source:MGI Symbol;Acc:MGI:1351655]


Sequence tag IST13411H2BBF1
Sequence
ACACACACTTATTNNACCTCTCCCCCTGCCTCACATTAAATCAAGAGTGGAANAAATCATAAAATTAAAAACCCAANAAA
AATTCCTGGAGTTGANAAACCANAGACTAATCCAAGACACAGAAAGATCACACAATGACACCGGGAGAACAGGTGACATC
GGGCGTGTTTTCTCTGANTCTGCCTCANCCCCANAAAAGCCCCCTTANAATGAAAGGAAGCAACNACTCCCAACCCTCNA
CAGTTTCCGGTGAGAGTCACCNTGGNNNCCANCCNCTGGGCGTGTCCGAGGGAATTTCNANAN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser

 
Come back to gene ENSMUSG00000029381


For any suggestions or comments, please send an email to unitrap@crg.es