Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone G052D04
Clone ID G052D04
Vector U3CEO
Project ggtc

Sequence tag G052D04
Sequence
TCCAGGTTGGAAGCCAACTTCTGGGTCCCTCCGTGGTCCAGACACCATATGCCAAGAGCCACCGTTCCCTACTTGGACAC
TGCTGCCCACAGCCCACAGTCAG
Sequence Type mRNA
Unitrap ID UNI11108

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 86253156..86253336 56
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000002885 (Cd97) NM_011925 CD97 antigen Gene [Source:MGI (curated);Acc:Cd97-001]

 
Come back to gene ENSMUSG00000002885


For any suggestions or comments, please send an email to unitrap@crg.es