Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone G052D05
Clone ID G052D05
Vector U3CEO
Project ggtc

Sequence tag G052D05
Sequence
CAGGGTGGAGTCTGCCTGTACAATACCGTGACAGTCATNNNGATTCACACCTGCACACACGCCGGCATTGCTCTCTCTTT
GATGTGTCCCACATGCTACAGACCAAGATATTTGGCTGTGACCGAGTGAAGCTGCTGGAGAGTGTAGTGGTTGGAGACAT
TGCGGAACTAAGGCCTAACCAGGGAACACTCTCTTTGTTTACCAACGAAGCTGGAGGCATCTTAGACGACTTGATTGTAA
GCAATACTTCTGCAGGGGCACCTGTATGTAGTATCCAATGCTGGCTGCCGGGACAAGGACTTGGCTCTCATGCAG
Sequence Type mRNA
Unitrap ID UNI1483

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 108199526..108201230 131
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000032607 (Amt) NM_001013814 aminomethyltransferase Gene [Source:MGI Symbol;Acc:MGI:3646700]

 
Come back to gene ENSMUSG00000032607


For any suggestions or comments, please send an email to unitrap@crg.es