Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST10885C11
Clone ID IST10885C11
Vector VICTR76
Project tigm

Sequence tag IST10885C11BBF1
Sequence
AGAAGGTTGCATCAGGAGTAAGAGGCTCACCTGTACCTCAATGCACCGCACAACACCGTGGAACGCTGAAGAGGCTGAAC
TTAGGCGTGTTCGATTAAGTTTTACAAAACACTCAGAAGGATCAGAAACGAGTTGTGTGAGTTANAAATCATTTTGGTGT
GTTACACACACCTCCTCAAAGTTTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCNCN

Sequence Type genomic DNA
Unitrap ID UNI31544

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 95775453..95775675 219
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000013418 (B4galnt2) NM_008081 beta-1,4-N-acetyl-galactosaminyl transferase 2 Gene [Source:MGI (curated);Acc:B4galnt2-001]


Sequence tag IST10885C11HMR1
Sequence
GGACTCAGGGATCCAGGCTCTTACACTTGCCTAAACCCACATCCTACAGCTGGGTACCAGACTCAGTCAGGTAGGCGCCT
GATCCCCGTTCAGCGCACCCGGCACCCCCAAGACACGACCCCACGCTCN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 95775721..95775848 128
NO GENE  


Sequence tag IST10885C11HMF1
Sequence
AGAAGGTTGCATCAGGAGTAAGAGGCTCANCTGTACCTCAATGCACCGCACAACACCGTGGAACGCTGAAGAGGCTGAAC
TTANGCGTGTTCGATTAAGTTTTACAAAACACTCAGAAGGATCANAAACGAGTTGTGTGAGTTANAAATCATTTTGGTGT
GTTACACACACCTCCTCAAAGTTTCTCTNTNTNTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTN
Sequence Type genomic DNA
Unitrap ID UNI31544

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 95775452..95775675 210
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000013418 (B4galnt2) NM_008081 beta-1,4-N-acetyl-galactosaminyl transferase 2 Gene [Source:MGI (curated);Acc:B4galnt2-001]

 
Come back to gene ENSMUSG00000013418


For any suggestions or comments, please send an email to unitrap@crg.es