Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone G049D04
Clone ID G049D04
Vector U3CEO
Project ggtc

Sequence tag G049D04
Sequence
TGTTAAAGCCCTACCAAAACCTGTAGAGAAGGTGCCTGTGTGTGAACCAGAGGTGGAACTTGCTGAGCCTGAGCCTGAAC
CTGAACTTGAACATGTTAGAGAAGACAAGCCTTCTCCTATACCTATTTTGGTTGATAATCCCTCTCCAAGCCCGATGGAA
ACATCTGGATGTGCGCCTGCAGAAGAGTATCTGTGTCAGGCTTTCTCTGATGTAATCCTTGCAGTGAGTGACGTAGACGC
AGATGATGGGGCTGACCCAAACCTCTGTAGTGAATATGTGAAAGATATCTATGCTTATCTCCGACAACTGGAG
Sequence Type mRNA
Unitrap ID UNI11114

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 13: 101553420..101555541 184
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000041431 (Ccnb1) NM_172301 cyclin B1 Gene [Source:MGI (curated);Acc:Ccnb1-001]

 
Come back to gene ENSMUSG00000041431


For any suggestions or comments, please send an email to unitrap@crg.es