Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone G048H06
Clone ID G048H06
Vector U3CEO
Project ggtc

Sequence tag G048H06
Sequence
GTANNNGATGGCTNNNGCAACCTACAGAAGCAAATTCAGATCGCTCAGCTCTTCGGGGTGCCGGTGGTGGTGGCACTGAA
TGTCTTCAAGACGGACACCCGTGCAGAGATTGACTTGGTGTGTGAGCTCGCTAAACGGGCCGGTGCCTTTGATGCGGTCC
CCTGCTATCACTGGTGGGGGGGAGGGAAAGGATCTGTGGACTTGGCCCGGGCTGTGAGAGAAGCTGCGAATAAAAGAAGC
CGCTTCCAGTTCCTGTATGATGTTCAGCTTCCCATCGTGAGAAAGATAAGAGTCACTGCCCATGTAGTTTAGGCAAGCTA
GATCCCATGTATGTCTGTAGCCGGGCTCTCTATGATCGCTCGGTATACTCCACAG
Sequence Type mRNA
Unitrap ID UNI10586

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 10: 6243198..6257228 173
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000040675 (Mthfd1l) NM_172308 methylenetetrahydrofolate dehydrogenase (NADP+ dependent) 1-like Gene [Source:MGI (curated);Acc:Mthfd1l-003]

 
Come back to gene ENSMUSG00000040675


For any suggestions or comments, please send an email to unitrap@crg.es