Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST10126B6
Clone ID IST10126B6
Vector VICTR76
Project tigm

Sequence tag IST10126B6BBR1
Sequence
ATTCAAACAGGAGCTTCTCTGACCAAACCTGGCAGTAGCACTAATATTTGGGCAAAACCATAATTATTTAGAGAGCAGTT
TTGATAAGTAGATTATGCCCATTTAGCAAAAACAGTTGTAGCTTCCTCACAAAGGCCTGTGACTTTACTTGTCATGTCTA
TGACACCATGTCTCTGTTTTGCATATCCTAGGAAACAGGAGTTTTCCTTTGTTCCATAGTGTGACACATAAGCCACACTA
TGCCTGTGCTTAATGTTACAAGAAGTTAGTTGTAAGTAGCTAACTATTCCTTTGAGGTGAGTGCTGGGGTCTGAACACCA
GTCCTCATGAATGCAAAGCAGGACAAACTTTGAACAACCATTTCCTTAACCTTCTTTTATTTGTGCTTTAGTATTATCAT
TATCATTATCATTATTATTATTATTATTATTGTGTGTATGTGTGGTGCTCGTGAATGGTATGTAATTGTGAGTGCATAAA
AGTCAGGACAACTTTTCTGGGTTCCAGGTATTGAGCATAGGTTATCAAGTTTGCAATATTGCCAGCCTGCTTAGTGCCTA
CTTCTTACTTAATTTTAAGTGTTTTTGTTTGTTG
Sequence Type genomic DNA
Unitrap ID UNI530

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 104443900..104444492 593
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000027176 (Cstf3) NM_145529 cleavage stimulation factor, 3' pre-RNA, subunit 3 Gene [Source:MGI (curated);Acc:Cstf3-001]


Sequence tag IST10126B6HMF1
Sequence
GAATGAGCAGTAGTTAATTATCACAGACTCAATAGAGACTAAGGCTGCAACTACACAGCTCAACAAAAGAACATGTAGCC
TTGAACATGTGGCAAGCACTTCAGAGACAGAAGCAGTTGCGTCTGAGTTTGAGGCCAGCCTGTTTACACAATTGAATTCC
AGAACAGCCAGAACTCCATAGTGCAACCATGTCTCAAAAAAAAAAAAAT
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 104443696..104443903 208
 
EST/CDNA Est Name
  DY247752.1

 
Come back to gene DY247752.1


For any suggestions or comments, please send an email to unitrap@crg.es