Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14570H7
Clone ID IST14570H7
Vector VICTR74
Project tigm

Sequence tag IST14570H7HMR1
Sequence
TANNNGNNNANNNGTNNGNNNNNNGNGNNNNTGNGCACAAGAATGCAGGTGCTTTTANAGGCCAAAGGCATCANATCCCA
GGAGCTGGAATTACAGATGGCGGTGAGCTGCCTGAAGTGCGTTCTGGGAACCAAGCGCTGGTGCTCTGGGAGAGAGCCAG
TACTCANCCTCTGANCCATCTTTCTAGTCCCCCCAAATTAATATATGCNTGTATCTCCANTCC
Sequence Type genomic DNA
Unitrap ID UNI30861

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 33018742..33018930 177
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000040183 (Ankrd6) NM_001012450 ankyrin repeat domain 6 Gene [Source:MGI (curated);Acc:Ankrd6-002]


Sequence tag IST14570H7HMF1
Sequence
CATACACAGTTCGAAATAATAACAAATCATTTTTTTTTAAAAATATGACCCAAATAAGGGCCAAGTTGTGAATCAAAATG
CTGGCAGTAAACAANACTGTGCTGGCAAACTTTACGTCAACCTGACNCAANCCANACTCNTTTTGGGAGGGANAANCTCA
NCNGANACGATGCTCTTACCCGATTGGTCNGNANGCNANACTGCGGTGCATTTTCTTGANGATTGANNTGGGAGGACN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser


Sequence tag IST14570H7BBF1
Sequence
CATACACAGTTCGAAATAATAACAAATCATTTTTTTTTAAAAATATGACCCAAATAAGGGCCAANTTGTGAATCAAAATG
CTGGCAGTAAACAAAACTGTGCTGGCAAACTTTACGTCAACCTGACACAAGCCAAAGTCATTTTGGGAGGGAAAANCTCA
TCTGANACAATGCTCTTACCCGATTGGTCTGTAGGCAAAACTGCGGTGCATTTTCTTGATGATTGAAGTGGGAGGACTGA
NATCACGGTGGGTGGTGCCGCCCCTGGGTCAAAGGGCTTTAAAAAGCAAGCTGAGCAAGCCAGTGGGCGTGGCCTCTGCT
TCACTTCCTGCCTTGATTTCTGTCTTGAATTCCTGTCCTGACTTCACTCAGTGATGACTGTGACCTGAGAGCANTNAGAA
GGAATAAACCCTTTCTTTCCACAGTGGCTTTTGGTCACGGCGTCTNNTCNGANCAN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 33018958..33019412 419
 
EST/CDNA Est Name
  CF533090.1 - BY719028.1 - BY320686.1 - AA153672.1

 
Come back to gene CF533090.1 - BY719028.1 - BY320686.1 - AA153672.1


For any suggestions or comments, please send an email to unitrap@crg.es