Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone G047B05
Clone ID G047B05
Vector U3CEO
Project ggtc

Sequence tag G047B05
Sequence
TCAACACAACAGATGCCTACGCAAAGGACCTGGACACGGTGGCTTCCGACATGATGGTTCTCCTGAAATCCTTCTTTGAT
TGCCATAAAGAATTCCAGACGGTTCCATTCTACATTTTCTCAGAATCCTACGGAGGAAAGATGGCTGCTGGCATCAGTGT
AGAACTTCCCAAGGCTGTTCAGCAAGGGTCCATTAAGTGCAACTTTTATGGGGGTGCCTGTGGTGATCTCCTGGATCTCN
NCCCGTGG
Sequence Type mRNA
Unitrap ID UNI8586

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 88802598..88805786 98
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000000278 (Scpep1) NM_029023 serine carboxypeptidase 1 Gene [Source:MGI (curated);Acc:Scpep1-001]

 
Come back to gene ENSMUSG00000000278


For any suggestions or comments, please send an email to unitrap@crg.es