Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST10945D7
Clone ID IST10945D7
Vector VICTR76
Project tigm

Sequence tag IST10945D7BBF1
Sequence
AGAAACNAAAAAATTCAGCCCTCTTGTCTTTCCCTTTGCAAGCTCTGGGAAATGACTAAGAGGGCCCTGGGCTGGCTATT
GTTTCTGGCTGTTTCTCCCCTAAACAATGCAGCCTGAAAACTATTTACATAGTGTTTGCATTGCATGTGGGCATGCTAAA
TCCCGGANATTAAAGTTTGGGAGTTGGAGATACTGCTCAGTGGGNNAGCTACACCCTTANCTGGTGTGAGGGCTTGGGCT
CTATACCCCATGTGGGGGTGGGGGGCAAACCAGAGGGTGTGCCAGACAGGATCT

Sequence Type genomic DNA
Unitrap ID UNI4185

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 168587491..168587783 283
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000027547 (Sall4) NM_201396 sal-like 4 (Drosophila) Gene [Source:MGI (curated);Acc:Sall4-002]


Sequence tag IST10945D7HMR1
Sequence
TCACTGTACCTGCTTTCCCTGGTACCCTGCGTCCGCTCAGCACTCAGCTGAGAAGGGAGCTATGGCACAAAAAAGGTTAA
GCATCTCTGCTCCCGAAGGATACACCAGCTCAGAGTGATTTACTACCGGGATGCCAACCGCCTTCACTGTATACACAAGC
CCCGAAGCCTCTCCCCCTGCAGCCTGACCGCTGCACCAGGCATCCCACTTAAAACTGTANCCGATGTTTGCTTANGCAGT
AAAAAACTACCTCGTCCATACCACCGTCGGCAAATANTGGGACGGAGTATTTGCCAANGANAAAGANGACCCTGTTAGGA
ACAATTGCTGGCTATGCNTANNTTANCCTGAAGGGAAGGAANGCN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 168587800..168588163 342
 
EST/CDNA Est Name
  BB694983.1 - CN682519.1 - CN671806.1 - CN686133.1 - CD545404.1 - CD541943.1 - CD541671.1 - CN698301.1 - BY068811.1 - CN678644.1 - CF163291.1 - CJ063524.1 - CF161804.1 - BY074202.1 - BB862840.1 - CN687116.1 - BB860761.1 - CF165824.1 - CN677097.1 - CN689061

 
Come back to gene BB694983.1 - CN682519.1 - CN671806.1 - CN686133.1 - CD545404.1 - CD541943.1 - CD541671.1 - CN698301.1 - BY068811.1 - CN678644.1 - CF163291.1 - CJ063524.1 - CF161804.1 - BY074202.1 - BB862840.1 - CN687116.1 - BB860761.1 - CF165824.1 - CN677097.1 - CN689061


For any suggestions or comments, please send an email to unitrap@crg.es