Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone G046H09
Clone ID G046H09
Vector U3CEO
Project ggtc

Sequence tag G046H09
Sequence
GAAAAGCAGTGAGGTGTTGTCATACGATTGATAGGTCTATATGCTCATTCGACCTCCTATGATAGAGTTAGCCTAGAGAT
AGCTCATGTTCGGATCAAAACCGGTCATGTCCATATAGTATCATGGAGGGAAGATTTCAATCCTCTTCGCCACATGATGA
GCGCCTGTCGGACAAGGAAACAGAAGATCTAATGGCGTGGATGAGAAATGCACTAGGGTCCCGTGTCACCAATGTGAAGG
TGACTTTCCGCCTAGACACCCACCCTGCCATGGTGACCGTGCTGGAGATGGGGGCTGCTCGGCATTTCTTGCGTATGCAG
CAGCTGGCCAAGACCCAGGAGGAACGTGCCCAACTGCAACAGCCCACACTTAGTATCAACCCCAG
Sequence Type mRNA
Unitrap ID UNI11119

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 16: 4043953..4843911 139
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000005981 (Trap1) NM_026508 TNF receptor-associated protein 1 Gene [Source:MGI (curated);Acc:Trap1-001]

 
Come back to gene ENSMUSG00000005981


For any suggestions or comments, please send an email to unitrap@crg.es