Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14758A5
Clone ID IST14758A5
Vector VICTR76
Project tigm

Sequence tag IST14758A5HMR1
Sequence
CTCATAGAGTGCCCTTAGATTCTTGACAGCAGTTTTTCCTTTGTTGCAGAATTGTCATTACACATTATGAATATTAGAAG
TTATTTTCTAAACTGCCTTAATTTGTCCTGCTTTTCTGTTGAGTGGACATGAGGATGATGAATGACATCTTTGAACGTTT
TACACTGAAGCACAAGTTGGATTGCTTGTGAACAGAAAGAGGGTGGAACAGAGTTGANAGTTTGGACCTGGTTACTACAC
TGGCAGATGTGTGTTTGATAGCTGATAAAGCAAACCTGTGTGTTTTCCCCAAACTCTTANCAAAAAATTGGGTTTTTTTG
TGCCTTGGTTTANTTNAANCANCTCTGGATTATCTATCNNAAAATTGTTACTGTGCTAACATTGGGGATATTTCTTGCTG
GATTGNATGTTGCTGTCCNGNNAA
Sequence Type genomic DNA
Unitrap ID UNI5169

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 92509957..92510374 398
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000029405 (G3bp2) NM_001080795 GTPase activating protein (SH3 domain) binding protein 2 Gene [Source:MGI Symbol;Acc:MGI:2442040]


Sequence tag IST14758A5HMF1
Sequence
TNNGTATCTGTAAATTTCCAGTAGCTGATACTGAAAATTTTGGTATTTTAATCTCTAATACAAGCTAGAGCTGCCCACAC
TGCCCTGCTACAAACAATGCCAACAATTTCTTCAAAACCAGAACTCACCTACTAATCCGGCTACTCAGGTCATTGAGTTA
ACG
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 92510374..92510532 159
 
EST/CDNA Est Name
  BY164040.1 - CB237560.1 - BU516107.1 - CN714913.1


Sequence tag IST14758A5BBF1
Sequence
TGAGTATCTGTAAATTTCCAGTAGCTGATACTGAAAATTTTGGTATTTTAATCTCTAATACAAGCTAGAGCTGCCCACAC
TGCCCTGCTACAAACAATGCCAACAATTTCTTCAAAACCAGAACTCACCTACTAATCCGGCTACTCAGGTCATTGAGTTA
ACATTTAGTCTAGATAGTAAACTTGCCCTAGGTTCACAGGCCAAGGCTGAACAAGAAACTGCCTTCATCATCAGCTAATG
GTGGTTGGGTCTGGGTACTAGCAAGGCAAATTGGTGCCTTGAACATGTCATTCAGACTCTTANCCAAAGTTAATCTTCTA
AATTATCGAATGAATTCTTTACCTACAGACAGCCACCCACTCTGCAAACATTCCGGTACTCCATCTGANGCTTGCTTCCC
CCATCGCTAATTCTAGTTTTGTGTGCTTTGTTTGAGTCTANGTCTTCTGTGNANCCNNGGCTGTCCNAGAACTCNCTGTA
C
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 92510371..92510850 462
 
EST/CDNA Est Name
  DV054232.1 - BG297799.1 - CB182254.1 - CN460401.1 - BQ884989.1 - CB244656.1 - CA327012.1 - BI078587.1 - CX239172.1 - BG174386.1 - BG079085.2 - BE917218.1 - BB652708.1 - BY738225.1 - BY740848.1 - CN673757.1 - CN460774.1 - CF914887.1 - CN661328.1 - BY736435

 
Come back to gene DV054232.1 - BG297799.1 - CB182254.1 - CN460401.1 - BQ884989.1 - CB244656.1 - CA327012.1 - BI078587.1 - CX239172.1 - BG174386.1 - BG079085.2 - BE917218.1 - BB652708.1 - BY738225.1 - BY740848.1 - CN673757.1 - CN460774.1 - CF914887.1 - CN661328.1 - BY736435


For any suggestions or comments, please send an email to unitrap@crg.es