Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14967B10
Clone ID IST14967B10
Vector VICTR76
Project tigm

Sequence tag IST14967B10HMR1
Sequence
GTAAAACCTTGGAAGCAGCCACATAGCTGAACAGAAAGCTGCCCCTTGCCGCTCGCTTGCCCGGACACTCAGGACTCAGG
TGCTGTTCCAGCCTACTCACCACAGATTGTCATCTGTGCCCGGGAGACCTGGCATTTCTGGGGTGCTCCTGTGACCCTTC
TGCAGTTCTGCGCCAGAGCTCTATTCAGGCAGTTGGATGACATGAACTTTGAGATGGAGTTTGTCACCCGTGAGGGACTG
GCTGCCTTTCCAAGGCTTGTGCTATCTGAAGGGACCATCTGAAGGACGTGTTTGTGTGTGGAAAAGANGGCNCCANCCTG
ACNTGCGTCCTCCACCNTGTTCCTGTTGCNNCCTTTTGANANCTTGANTGN
Sequence Type genomic DNA
Unitrap ID UNI4971

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 24301319..24301688 350
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000031545 (Agpat6) NM_018743 1-acylglycerol-3-phosphate O-acyltransferase 6 (lysophosphatidic acid acyltransferase, zeta) Gene [Source:MGI Symbol;Acc:MGI:2142716]


Sequence tag IST14967B10BBF1
Sequence
TTACTTTCCTCCTGCCCCAAAGCATTCAGCGGGTAAATTTGTCCTAAAGATCTGTC
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 24301685..24301739 55
NO GENE  


Sequence tag IST14967B10HMF1
Sequence
TTACTTTCCTCCTGCCCCAAAGCATTCAGCGGGTAAATTTGTCCTAAAGATCTGTATTGTCAGAAGTACCAAGAAGAGTT
CGCCTTGGTGCCAGAAGAATCCTGAAACTCCAGTAGACAAGGGTAGCTGCTGGCACTTCACACCCAAGGCTGCCAAACGT
CAGTATGTANAAATTAAGTAACGTTTACTTAAAATTCCTTCATAAGCTAAAACTGAGTTCACTGTAAAGAGTTCATAGCT
GGTCCCATGCTCCCTTGAGGGGGCTCCTGATGCTGGCTGACCCAGGACCCTCCTACCCNNANAGCCCCAGCCTTTGCCAG
TANCACACANANGCTGGCACANAACGTCTCATGCTGCCTGTACTGAGCACTGTTCCNAACACNCCTGGCATTGGTGTCCT
NNNANATTCTTCTN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 24301685..24302097 385
 
EST/CDNA Est Name
  BB853277.1 - BI248073.1 - BI684039.1 - BI657969.1 - CO425114.1 - CK782058.1 - BF467121.1 - BG974728.1 - BU151844.1 - CN666398.1 - BG077225.2 - BY247587.1 - CF161526.1 - DN175019.1 - CX211356.1 - BB652684.1 - CD546398.1 - BY248660.1 - BY244547.1 - AI119513

 
Come back to gene BB853277.1 - BI248073.1 - BI684039.1 - BI657969.1 - CO425114.1 - CK782058.1 - BF467121.1 - BG974728.1 - BU151844.1 - CN666398.1 - BG077225.2 - BY247587.1 - CF161526.1 - DN175019.1 - CX211356.1 - BB652684.1 - CD546398.1 - BY248660.1 - BY244547.1 - AI119513


For any suggestions or comments, please send an email to unitrap@crg.es