Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14155G10
Clone ID IST14155G10
Vector VICTR74
Project tigm

Sequence tag IST14155G10HMR1
Sequence
TTGTTCTCTTTAGACACACCANAAGAGGGCATCAGATCCCATACAGATGGGCATGAGCCACCATGTGGTTGCTGGGAACT
GAACTCAGAATCTCTGGAAGAGCAGTTGGCACTCTCAACCACTCANCCATCTTTCCAGCCCCCAACCCTAAAATTCTATT
TATTCTCTTGTTTTTTGTTTTGTTGTTTTGGTTTTGTTCTATTGGGGTTTTTTGTTTGTTTTGTTTTGTTGTTTTGNNNA
NNTTTTTGGN
Sequence Type genomic DNA
Unitrap ID UNI13524

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 54053315..54053563 233
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000006599 (Gtf2h1) NM_008186 general transcription factor II H, polypeptide 1 Gene [Source:MGI (curated);Acc:Gtf2h1-001]


Sequence tag IST14155G10HMF1
Sequence
CAATGGTGTACTTATATACATAAAATAAG
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser

 
Come back to gene ENSMUSG00000006599


For any suggestions or comments, please send an email to unitrap@crg.es