Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14052C2
Clone ID IST14052C2
Vector VICTR74
Project tigm

Sequence tag IST14052C2BBF1
Sequence
GGCTCAGTGGGTAANAGCACCCGACTGCTCTTCCAAAGGTCTGGAGTTCAAATCCCAGCAACCACATGGTGGCTCACAAC
CACCAGTAATGAGATCTGT
Sequence Type genomic DNA
Unitrap ID UNI5947 UNI30191

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 1: 180301362..180301459 92
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 10: 20473160..20473257 92
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 11662688..11662785 92
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000018654 (Ikzf1) NM_009578 IKAROS family zinc finger 1 Gene [Source:MGI (curated);Acc:Ikzf1-003]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 12: 82379638..82379735 92
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 13: 67370545..67370642 92
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 14: 102409114..102409211 92
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 15: 59376397..59376494 92
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000059586 (Nsmce2) NM_026746 non-SMC element 2 homolog (MMS21, S. cerevisiae) Gene [Source:MGI Symbol;Acc:MGI:1915751]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 16: 91645599..91645696 92
 
EST/CDNA Est Name
  CF899687.1 - CX238156.1
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 38138973..38139070 92
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 18: 34899212..34899309 92
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 127031950..127032047 92
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 85399643..85399740 92
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 117747518..117747615 92
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 75533388..75533485 92
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 6: 128417097..128417194 92
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 25705648..25705745 92
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 85227048..85227145 92
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 62180961..62181058 92
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr X: 126089166..126089263 92
NO GENE  

 
Come back to gene CF899687.1 - CX238156.1


For any suggestions or comments, please send an email to unitrap@crg.es