Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST12332F1
Clone ID IST12332F1
Vector VICTR76
Project tigm

Sequence tag IST12332F1HMF1
Sequence
CTTTCTTTCTTCCTTCCTTCCTTCCTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCT
Sequence Type genomic DNA
Unitrap ID UNI31282

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 1: 36085783..36085852 70
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 10: 12656600..12656669 70
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 25113642..25113711 70
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 12: 3943907..3943976 70
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 13: 9298928..9298997 70
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000048264 (Dip2c) NM_001081426 DIP2 disco-interacting protein 2 homolog C (Drosophila) Gene [Source:MGI Symbol;Acc:MGI:1920179]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 14: 49243710..49243779 70
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 15: 4791962..4792031 70
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 16: 25963517..25963586 70
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 21328298..21328367 70
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 18: 19949331..19949400 70
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 19: 52598638..52598707 70
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 9118091..9118160 70
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 39216690..39216759 70
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 13149724..13149793 70
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 84012513..84012582 70
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 27203813..27203882 70
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 25641299..25641368 70
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 27705066..27705135 70
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr NT_161925: 345935..346004 70
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr NT_166392: 220850..220919 70
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr X: 23566932..23567001 70
NO GENE  


Sequence tag IST12332F1BBF1
Sequence
CAANAAAGAACGACAAAAAGGCTATACAGGCTATTTTAAATGTACAAAATTTATATCTGTGTATACTGCAAATAATGTGC
CTTCCAAAAAGGCTAAAATGTAAAGGCAAAACAAATTATTTCACTGATGAACCACTCATTTGGTAATGTCTTTCTTTACA
TTTGGGTTTTTTTTTTTAAAAATCTN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 25036437..25036621 183
NO GENE  

 
Come back to gene ENSMUSG00000048264


For any suggestions or comments, please send an email to unitrap@crg.es