Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone G047C12
Clone ID G047C12
Vector U3CEO
Project ggtc

Sequence tag G047C12
Sequence
CGGGGGAGGGAAGATGTCGGGCTCATCGCTCCCCGGCGCCCTGGCCCTCTCGCTCATGCTGGTCTCTGGCTCGCTCCTTC
CAGGGCCAGGCGCTGCTCAGAACG
Sequence Type mRNA
Unitrap ID UNI11122

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 58430236..58430333 92
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000032336 (Nptn) NM_009145 neuroplastin Gene [Source:MGI Symbol;Acc:MGI:108077]

 
Come back to gene ENSMUSG00000032336


For any suggestions or comments, please send an email to unitrap@crg.es