Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST10365C12
Clone ID IST10365C12
Vector VICTR76
Project tigm

Sequence tag IST10365C12HMR1
Sequence
GNTCTGGGGGGCTGCGGGGCTCGGTGCTGANCGGCGGAGGGAGGAGGAAGAAGGATGCGT
Sequence Type genomic DNA
Unitrap ID UNI31560

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 123438547..123438603 55
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000029475 (Fbxl10) NM_001003953 F-box and leucine-rich repeat protein 10 Gene [Source:MGI (curated);Acc:Fbxl10-003]


Sequence tag IST10365C12HMF1
Sequence
ATCCCAGGCGAACCCCGAGCCCGCTCAGTCCCTTCCACGCCTTTCGGCGTTGCCTCCTCCCCACTTAAGTGTCTGAGACC
CTGAGCCTCACAAGAGACTGGAGGAGTAAGCTGCTTGCTTCCTTTTGCATGCAATTTATTATTTTTTTCCGGTCCTCTTG
CAAAATACAGAAAAGGAAAGAAAAGGCAGCAAGAAACAACCAAAAAAATAAATAGATAGATAAATCGATCATATNCNNNA
TACNNATTTGGGGGANAAAAAAAAAGCTACNCNCCANTCTTNTTCNNNANTCTTTCTCTGCCTCCNTTTTTTTAGGANAG
TTCACCAATTAATTGTNAACG
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser

 
Come back to gene ENSMUSG00000029475


For any suggestions or comments, please send an email to unitrap@crg.es