Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST10813D11
Clone ID IST10813D11
Vector VICTR76
Project tigm

Sequence tag IST10813D11BBF1
Sequence
GTGAGATATGAAGAATTAGGTTTGTATTCTCTTTGTACATCAAGCTTCCGTTAGTACTGTAACATTAAAAATTTGTTGTG
TGGTTAAACCTTCATTTGTTCTTCTTGAAGAGTGTTATAGTGTGGTTGTAAATCAGAGGAGAAATATTCAAAAGTCAAGA
GAGGTTTAGTTAAGGGCATAATGTAAGCAGGAGGGCCAAGAAGGCAGGGTCTAAGAGATACTAGACTATTCTAGTATCTT
AGGGCTTGGATCT

Sequence Type genomic DNA
Unitrap ID UNI14648

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 15116615..15116866 252
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000079709 (AC182749.2-203) NP_001116842 Putative uncharacterized protein [Source:UniProtKB/TrEMBL;Acc:Q8C5D3]

 
Come back to gene ENSMUSG00000079709


For any suggestions or comments, please send an email to unitrap@crg.es