Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14989G6
Clone ID IST14989G6
Vector VICTR80
Project tigm

Sequence tag IST14989G6BBF2
Sequence
GGTTGAGATCGTTTCGGCCCCAAGACCTCTAATCATTCGCTTTACCGGATAAAACTGCGTACGTCGGGAGCGAGAGCGCC
AGCTATCCTGAGGGAAACTTCGGAGGGAACCAGCTACTAGATGGTTCGATTAGTCTTTCGCCCCTATACCCAGGTCGGAC
GACCGATTTGCACGTCAGGACCGCTACGGACCTCCACCAGAGTTTCCTCTGGCTTCGCCCTGCCCAGGCATAGTTCACCA
TCTTTCGGGTCCTAACGCGTACGCTCGTGCTCCACCTCCCCGGCGCGGCGGGCGAGACGGGCCGGTGGTGCGCCCTCGGC
GGACTGGAGAGGCCTCGGGATCT
Sequence Type genomic DNA
Unitrap ID UNI30685

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 16: 57391344..57391690 325
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000075007 (AC144776.2) FIL1L_MOUSE Isoform 2 of Q6P6L0 - Mus musculus (Mouse) [Source:UniprotKB/SpliceVariant;Acc:Q6P6L0-2]


Sequence tag IST14989G6HMF1
Sequence
TTACCAGCTAAATAGGTACAAATAGGTTTAAAATTTCTGGTCACAAGGAGAAAAAACATGAACTAATAGCTATTAAAAAT
GGGAGCCCCAAGTTTTTCAGATGTTTCAACACCTTTTGCGTTTTCCTGGGAGGACAGAGGGTATAGCGTATGTTGCAAGT
GTTAAAACAGGCTTTCCCACAGCTTCAGCTTCCACTTCCCATTTTGTAACTCCCCGAGCGGCTGCCATTTCATGCGAAAC
AAGATGGAGGTCTCTCGGAAAGTGACCGGCCCTGCGAGTGGCTTCTGAGGTGGTGACACTTTGTACTGGTTTATACTGGG
AATGCTCCTGTAGGGACGACCTGCAGCCTCCGGCTGCTCTCGGGGCCACTTTTCCGAGCCCGGGTACACGAGCGCTTTGG
TGCTTGCCTACGTCCGCCATGTTNNNCTGCGGTCTCAGCCCAGCAAGGCCATGGTCNCTGCN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 19: 5802875..5803334 452
NO GENE  


Sequence tag IST14989G6HMR1
Sequence
TTAAATGGGTAAGAAGCCCGGCTCGCTGGCGTGGAGCCGGGCGTGGAATGCGAGTGCCTAGTGGGCCACTTTTGGTAAGC
AGAACTGGCGCTGCGGGATGAACCGAACGCCGGGTTAAGGCGCCCGATGCCGACGCTCATCAGACCCCAGAAAAGGTGTT
GGTTGATATAGAC
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 13: 44964941..44965111 164
 
EST/CDNA Est Name
  W20589.1

 
Come back to gene W20589.1


For any suggestions or comments, please send an email to unitrap@crg.es