Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST15069H4
Clone ID IST15069H4
Vector VICTR80
Project tigm

Sequence tag IST15069H4HMR1
Sequence
CTCTGGTCCCAGTCCCGGCAAAGAAACCAAAGTAAAAGAACCTACGTGGAGCTGGTGGGAGT
Sequence Type genomic DNA
Unitrap ID UNI31565

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 30758110..30758171 62
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000050737 (Ptges) NM_022415 prostaglandin E synthase 3 (cytosolic) Gene [Source:MGI (curated);Acc:Ptges-001]


Sequence tag IST15069H4BBF1
Sequence
CAGAGAATGTCTGTGGTCCCTCAAGGCACCCTCTAGGGTGCCACAAGTGTGTGCGGCGTCCATGGGGAGTGGGAATTTCC
ACGGAAAGACTTCTTAGGCTCCTGCGTTGCGGGTTCCCACTCCACCCAGATATGAGATCTG
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 30758167..30758306 140
NO GENE  

 
Come back to gene ENSMUSG00000050737


For any suggestions or comments, please send an email to unitrap@crg.es