Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone CG0731
Clone ID CG0731
Vector pGT0lxrT2
Project sanger

Sequence tag CG0731
Sequence
GATTTTCCCGGGGGGGAAAATAAACCCTGACCCCGGGGATTGAGTTTGACTTTTTTTTTTTTTTTTAGCCCTCAGGGGAC
ATAGATTCCCCAGTTGAACTCCAAGTGTTCAGAGAAGCTATAACACTCTAGGGAGAGAAGACGATCAATTAGAGCCATGA
GAGAGGAAATCAAAGTTGTATGCATAGGGGGTCCATAGAAGCGCAAGACGATTCCAGATAAGAGCAACCGGGCGGAGGCG
TCCCGGGGTCCGTGGAGAGTGGCGGCGGGCGGCGGCGGGCCGGGCCGCGCGGGGCGCGATGCTGAACATGTGGAAGGTGC
GGGAGCTGGTGGACAAAGC
Sequence Type mRNA
Unitrap ID UNI1428

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 45306480..45665694 109
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000006169 (Clint1) NM_001045520 clathrin interactor 1 Gene [Source:MGI (curated);Acc:Clint1-002]

 
Come back to gene ENSMUSG00000006169


For any suggestions or comments, please send an email to unitrap@crg.es