Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14139D9
Clone ID IST14139D9
Vector VICTR74
Project tigm

Sequence tag IST14139D9HMR1
Sequence
AACACACTTAAGCATGTGTGTGTCCCTGCATAGTACATTTTTAATGTATTATTGCAAATTGTTAGCAAGAAGGTGTGCTT
ATTTGCAAATTTTCCAGTAGTAGTAATATAAGGTGACATAGGACATTTTCCTACACTGTATTCAGTGGATTTTGCAGAAT
TTGTCAGTGGAATCCCAATGGAATGAGAAGCTATTGGCAAGAGGATCTCTGTCTCTAAATTATCTCCTACCTTTTCTACA
GCCTAGGGAAGCTTTGTAAACAATACCTCTATGCATGCATGCATGCTTGCTTGCTTTCTTTCTTTCTTTCTTTCTTTCTT
TCTTTCTTTCTTTCTTTCTTTCTTTTTTTCTAAACTATTTTCATACTTAAAAGGCAAAGACAGTAAGTATAGTGTTCCCT
TATATCCCTCACCCAGTTCCNATTCCTTGTTATCCTTCCACCGACTGCANGNNNNTATCNACAAAGANATGACATTGATG
CNTCTCTATTANCTACAGTCCANGTATCTNNNTGCANTCTCTGGTTTCACAGTTTCN
Sequence Type genomic DNA
Unitrap ID UNI10851

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 70336696..70337231 506
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000032217 (Rnf111) NM_033604 ring finger 111 Gene [Source:MGI Symbol;Acc:MGI:1934919]


Sequence tag IST14139D9HMF1
Sequence
TGTTTATGTATGTTCTATCTAGTTTTTGTGATATGAAGATATAAACATTATTTGTAAGACAGTAGTTC
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 70337228..70337294 67
NO GENE  


Sequence tag IST14139D9BBF1
Sequence
TGTTTATGTATGTTCTATCTAGTTTTTGTGATATGAAGATATAAACATTATTTGTAAGACAGTAGTTAACCTAGGTAAGT
CACCAAGAGGGTAAAATATGAAAATTAAGTCACTGGTTCTTATGTGTGTGTGGAGAGAGAGAGAGAGAGAGAGAGAGAGA
GAGAGAGAGAGAGN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 70337228..70337400 173
 
EST/CDNA Est Name
  CA883725.1

 
Come back to gene CA883725.1


For any suggestions or comments, please send an email to unitrap@crg.es