Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST15004F6
Clone ID IST15004F6
Vector VICTR78
Project tigm

Sequence tag IST15004F6HMR1
Sequence
CCCTCTCTCCCTGCCCTCTCCTCCATTCGGCCCCCAGGGCTCCCATTTTGTTCTCAACTCCTCCTCCGTGTCCAGCTGCT
TCTGGGATGCCTGGGACTAAAAACCTGTTATCTC
Sequence Type genomic DNA
Unitrap ID UNI5870

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 13: 101494156..101494269 114
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000069089 (Cdk7) NM_009874 cyclin-dependent kinase 7 (homolog of Xenopus MO15 cdk-activating kinase) Gene [Source:MGI Symbol;Acc:MGI:102956]


Sequence tag IST15004F6BBF1
Sequence
AGGGGGCACTGGGGTTGATGTTAACTGGGAATGCTTGAGCGGTTTGGGTTTTTAGTTCTGTATCAGGCTCCTGAGTAGAA
TGGGAGGTGGGGTTANTTTTTGCAANANTCTCCNNTATTAAAAAGCTGTTGGGTGACNNATGATGGGGTAAGGAACACTG
GANTTNNGTGGGGCTNTGGCNGNGAN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser

 
Come back to gene ENSMUSG00000069089


For any suggestions or comments, please send an email to unitrap@crg.es