Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST13978F2
Clone ID IST13978F2
Vector VICTR74
Project tigm

Sequence tag IST13978F2BBF1
Sequence
AGTACACTGTAGCTGTCTTCCGACACTCCAGAAGANAGAGTCAGATCTG
Sequence Type genomic DNA
Unitrap ID UNI29342 UNI30995 UNI30996 UNI31575

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 38138932..38138979 46
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 16: 16028767..16028814 46
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000041974 (2310008H04Rik) NM_146068 RIKEN cDNA 2310008H04 gene Gene [Source:MGI Symbol;Acc:MGI:1924834]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 15: 23000039..23000086 46
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000040420 (Cdh18) cadherin 18 Gene [Source:MGI Symbol;Acc:MGI:1344366]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 13: 14619196..14619243 46
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 12: 82379729..82379776 46
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000053302 (AC124384.4) Putative uncharacterized protein [Source:UniProtKB/TrEMBL;Acc:Q3UWJ8]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 14: 65725984..65726031 46
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 25705607..25705654 46
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000040940 (Arhgef1) NP_001123622 Rho guanine nucleotide exchange factor (GEF) 1 Gene [Source:MGI (curated);Acc:Arhgef1-002]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 143651986..143652033 46
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 87761479..87761526 46
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 87659624..87659671 46
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 1: 193225758..193225805 46
NO GENE  


Sequence tag IST13978F2HMF2
Sequence
AGTACACTGTAGCTGTCTTCCGACACTCCAGAAGAGAGAGTCAGATCTCATTACAGGTGGTTGTGAGCCACCATGTGGTT
GCTGGGATTTGAACTCCAGACCTTCGGAAGAGCAGTCGGGTGCTCTTACCCACTGAGCCATCTCACCAGCCCCTAATATT
A
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 15: 58306609..58306768 156
NO GENE  

 
Come back to gene ENSMUSG00000040940


For any suggestions or comments, please send an email to unitrap@crg.es