Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone G045D03
Clone ID G045D03
Vector U3CEO
Project ggtc

Sequence tag G045D03
Sequence
TCGACTCCAGCCCTGGTGCAGCTTCTGGCCCCGGCTTGAAGAGCAACTTGTCTTCGTTGCCAGTGCCCACCACCACTGGA
CTGTTGTCGCTGCCAGCTTGCCCTGAGGAGTCCCCGCTGCTC
Sequence Type mRNA
Unitrap ID UNI9030

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 40800425..40800546 122
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000028413 (B4galt1) NM_022305 UDP-Gal:betaGlcNAc beta 1,4- galactosyltransferase, polypeptide 1 Gene [Source:MGI (curated);Acc:B4galt1-001]

 
Come back to gene ENSMUSG00000028413


For any suggestions or comments, please send an email to unitrap@crg.es