Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone G051B02
Clone ID G051B02
Vector U3CEO
Project ggtc

Sequence tag G051B02
Sequence
CNNNTACAACNNCATTACGCCTCTTTCAGGCCAAGCTTGCAAGCTCCTTTCTGTAACTCAGCGGTCATGGGAGTTTCTGT
GTGATGTGTTCTGCGTGACTCTACTGGGTGTTGTGAGAGAAGGTTAGTCAAGCTCAGAACTCCAAACGTGTGTCTTCGCT
GGATGCTGTGAATTTAGCTTAAGCAAGCTCAGAACTTCACACAT
Sequence Type mRNA
Unitrap ID UNI11137

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 176987533..176991177 127
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000078870 (OTTMUSG00000016578) NP_001107278 predicted gene, OTTMUSG00000016578 Gene [Source:MGI Symbol;Acc:MGI:3709158]

 
Come back to gene ENSMUSG00000078870


For any suggestions or comments, please send an email to unitrap@crg.es