Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone CG0713
Clone ID CG0713
Vector pGT0lxrT2
Project sanger

Sequence tag CG0713
Sequence
ACAGCCTACAGGNGTAAGCAGCTTTCTGACACCTCAATCATTGCGGTCGCGTCTCACTGCCCTTTACTGCAGAAAGTCCA
CGTAGGCAACCAGGACAAGCTCACCGATGAAGGACTTAAGCAGCTGGGCTCAAGATGCAGAGAACTCAAAGACATCCATT
TTGGCCAGTGTTACAAGATCTCAGATGAAGGCATGATTGTCATAGCTAAGAGCTGCCTGAAGTTACAGAGGATATACATG
CAGGAAAACAAATTAGTGACAGATCAGTCAGTGAAGGCATTTGCTGAGCACTGTCCTGAACTCCAGTATGTTGGCTTCAT
GGGTTGTTCAGTTACTTCCAAAGGAGTCATTCACTTAACCAAG
Sequence Type mRNA
Unitrap ID UNI1431

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 63734294..63837183 137
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000023965 (Fbxl17) F-box and leucine-rich repeat protein 17 Gene [Source:MGI Symbol;Acc:MGI:1354704]

 
Come back to gene ENSMUSG00000023965


For any suggestions or comments, please send an email to unitrap@crg.es