Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14158A8
Clone ID IST14158A8
Vector VICTR74
Project tigm

Sequence tag IST14158A8HMR1
Sequence
AACAAAAAACACCTCTGAGGGTAGCTTCCAGCCTGCGCAGGTACCAGTACACCCACACACCCGATTACACACGCGGGTGT
GCACATGCACACGGCAAAGGAAGGGAATGGCTACTTGAACATACTCATTGCAATACACTCNTNGCNATACTGCAACNGN
Sequence Type genomic DNA
Unitrap ID UNI30861

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 33015623..33015778 150
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000040183 (Ankrd6) NM_001012450 ankyrin repeat domain 6 Gene [Source:MGI (curated);Acc:Ankrd6-002]


Sequence tag IST14158A8HMF1
Sequence
GTTNANATGCCATCCTTTCTTCCCACCACATCAGTCTCTTCGCCTGGGCTCTGGGACACAAACTCAAGCCTCCTGCTTGC
TCAGCATCACATTGGCAGCGGANCTGAAAAACACGTGGGGATGCCCTCTCTACNCGACAATCTGGCAACCGTTCTTCAAC
TTTNAANNNTTCCATCTCGTAACTATTTCTACACAAAAAGTCTGTTTTACAAAACACATTTCCCATGANTACAAACATAA
AAGCCACAAGGGCTACCAACCAGGAGGCTGCCCTGCTGGCAGGAGGCACANANANACAGTTTNGTCTCTCTNAAAAANCT
GACNNANACCAANANTAATTGATTTAAAAAAAAAN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser

 
Come back to gene ENSMUSG00000040183


For any suggestions or comments, please send an email to unitrap@crg.es