Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST10611G8
Clone ID IST10611G8
Vector VICTR76
Project tigm

Sequence tag IST10611G8HMF1
Sequence
AGGTATTGCTGGTCTTAGAGCATGTACTGGCTAATTTTGGGTCAACG

Sequence Type genomic DNA
Unitrap ID UNI2143

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 13: 62623888..62623933 46
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000074865 (6720457D02Rik) RIKEN cDNA 6720457D02 gene Gene [Source:MGI Symbol;Acc:MGI:1924367]

 
Come back to gene ENSMUSG00000074865


For any suggestions or comments, please send an email to unitrap@crg.es