Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST13662H3
Clone ID IST13662H3
Vector VICTR74
Project tigm

Sequence tag IST13662H3HMR1
Sequence
CGACTAGGTGGAGAAATGGAACCGACGTGATCAGAAGCTGCTGGAGGCGGTGCAGCGGGGGGACGTGGGACGCGTGGCTG
CCTTGGCCTCTAGGAAGTCAGCCCGACCCACCAAACTANACTCAAAT
Sequence Type genomic DNA
Unitrap ID UNI22153

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 96482049..96482175 125
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000038354 (Ankrd35) NM_001081139 ankyrin repeat domain 35 Gene [Source:MGI (curated);Acc:Ankrd35-001]


Sequence tag IST13662H3BBF1
Sequence
TGGGTAANANCACCTGACTGCTCTTCTGAAGGTCTGAAGTTCAAATTCCAGCAACCACATGGTGGCTCACAACCATCTGT
AATGAGATCTGT
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 77492827..77492917 87
NO GENE  

 
Come back to gene ENSMUSG00000038354


For any suggestions or comments, please send an email to unitrap@crg.es