Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14329C8
Clone ID IST14329C8
Vector VICTR74
Project tigm

Sequence tag IST14329C8HMR1
Sequence
GCNTTACTTCATGTCTTCCACTCTCAAGAAACTCTTGAATAAAACCAACAAGAAAGTAGCAGAATCCTAAAGACACCTGC
CTCCCAGCCCTCTCAGGACGCCGGGATAGGTGCTTGCTGTGCAGCTGGGTCAGAGTCCCCAGCTCATCAGACTTGCCTAA
CACATCACTGCCTCTCTGCACCCTCCCCGAGTTCCCATTTCCAGGAACCTAGAGGACTGGGGCATCTCTTTCNNANGCCA
AAGGGCACTTGGGAGTTTTCNGTGCANCCNNGGAANATGGGACAN
Sequence Type genomic DNA
Unitrap ID UNI22962

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 21158163..21158446 266
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000057193 (Slc44a2) NM_152808 solute carrier family 44, member 2 Gene [Source:MGI Symbol;Acc:MGI:1915932]


Sequence tag IST14329C8HMF1
Sequence
GCCTCTCGGCTGAACCGTCATTTCTCTCCAGATCCTCCACTGTGGACAGAGCCCCAAAGCAGGTAACATGAGAGGGAGTC
C
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 21158085..21158164 80
NO GENE  

 
Come back to gene ENSMUSG00000057193


For any suggestions or comments, please send an email to unitrap@crg.es