Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14791B3
Clone ID IST14791B3
Vector VICTR76
Project tigm

Sequence tag IST14791B3HMR1
Sequence
NCGTTTTGTATTTTCTCTTGTCAAACCACGTATCTCTCCTCGAACACCATTCCCTTCCTCTCCACCAGTAATCTTCAAAT
ACACTTTTTGTTGTGAATGTGACGAGCTTTTAAAATGAATATTGTTTTGTTTATTTCCTGCATAATCACCTACTTGTCAT
TACCAC
Sequence Type genomic DNA
Unitrap ID UNI12892

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 84311177..84311340 164
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000027082 (Tfpi) NM_011576 tissue factor pathway inhibitor Gene [Source:MGI (curated);Acc:Tfpi-001]


Sequence tag IST14791B3HMF1
Sequence
TTACAAGCCGGGCGTGGTGACACAGGCTAGCCTATGCCTGTCCCAAGAACAAAGCTTTAATCTGCACTCATCATGGTGAT
AAGTGATTGATGGTGATTGACTTAGATGTCAGGATATGATCATCTGTGCCTAGGGAAGTGGTTCTCAACCTTCGTCATGC
TGCGACTCATTAATACAGATCCTCATGGTCTCTAGCCGGAAGATATTTCATTGCTACTTCATAACTAATTTTGCTAATGT
TACAAATCATAATGTAAATATGTAATATGCGGCCCCAAGGTCACNACCCACAGTTTGAGAAGCACCGGTCTANGGGGATC
TGTGTGATGTATCTTGCTGGGTAAAANATANGGGGCTTTNTCTNAATGTTCNTTCN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 84311357..84311730 358
 
EST/CDNA Est Name
  AA763530.1 - CB572639.1 - BU697222.1 - CN691357.1 - CK390649.1 - BU698278.1 - CD554314.1 - CV561102.1 - CD552511.1 - CA568750.1 - BM729821.1 - CA541246.1 - CB573154.1 - BM729885.1 - CD554873.1 - CK390187.1 - CK392725.1 - CN691793.1 - CN700998.1 - BG311712


Sequence tag IST14791B3BBF1
Sequence
NTACAAGCCGGGCGTGGTGACACAGGCTAGCCTATGCCTGTCCCAAGAACAAAGCTTTAATCTGCACTCATCATGGTGAT
AAGTGATTGATGGTGATTGACTTAGATGTCAGGATATGATCATCTGTGCCTAGGGAAGTGGTTCTCAACCTTCGTCATGC
TGCGACTCATTAATACAGATCCTCATGGTCTCTAGCCGGAAGATATTTCATTGCTACTTCATAACTAATTTTGCTAATGT
TACAAATCATAATGTAAATATGTAATATGCGGCCCCAAGGTCACGACCCACAGTTTGAGAANCACCGGTCTAGGGGGATC
TGTGTGATGTATCNTGCNGGGTATAAGATANGGGGCTTTTTCTAAATGTTCCNTCANCNNANTTNACTATANANAANGAT
CCNNTCNNANTCNCCNNNNNCTTATCCNANNANNTCNNACCTGTGACTCANANANNTGN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser

 
Come back to gene AA763530.1 - CB572639.1 - BU697222.1 - CN691357.1 - CK390649.1 - BU698278.1 - CD554314.1 - CV561102.1 - CD552511.1 - CA568750.1 - BM729821.1 - CA541246.1 - CB573154.1 - BM729885.1 - CD554873.1 - CK390187.1 - CK392725.1 - CN691793.1 - CN700998.1 - BG311712


For any suggestions or comments, please send an email to unitrap@crg.es