Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone G055G09
Clone ID G055G09
Vector U3CEO
Project ggtc

Sequence tag G055G09
Sequence
TCCATATGCATCCCCAGTCTTTGGGCCTGCGACGGGGATGTCGACTGTGTTGACGGCTCCGATGAGTGGCCACAGAACTG
CCAGGGCCGAGACACGGCCTCCAAAGGCGTTAGCAGCCCCTGCTCCTCCCTGGAGTTCCACTGTGGTAGCAGTGAGTGTA
TCCATCGCAGCTGGGTCTGTGACGGCGAGGCAGACTGCAAGGACAAGTCAGATGAGGAGCACTGCGCGGTGGCCACCTGC
CGCCTTAACCTCTTTGCAGTGCANNGACGGCTTCGCCGTGGCAGGGGTTCTTACAGACATCGAGCAGTTCTTTAACATCG
GAAATGGTAGTACTGGCCTCATCCAGACTG
Sequence Type mRNA
Unitrap ID UNI9032

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 21538093..21539696 226
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000032193 (Ldlr) NM_010700 low density lipoprotein receptor Gene [Source:MGI Symbol;Acc:MGI:96765]

 
Come back to gene ENSMUSG00000032193


For any suggestions or comments, please send an email to unitrap@crg.es