Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST10709C3
Clone ID IST10709C3
Vector VICTR76
Project tigm

Sequence tag IST10709C3HMF1
Sequence
GCTGCAAATACCAAGCGCGGGTTTCAGAAAACCCCATTGTCTATAAACACCAGAGAAACCAAACTCAGGCAGACCTAAAC
TCAGACTGTGCCATGTTTTCANAGACATAGGACGAAACACAGACAACAAACCAACAGAAGGAGCACATGTTCGTTTTGGA
AACATAAGACAGACACTCANAACAAGGACACCGGCCACCACACACACAAGAGGGGATTCCCCAATTTTCTCTCTGTCCCT
GGGAGAGTTTCAAAATCCACTTTCCTCCTGCCTCATGCAGTTTCCAACTGCGGCCATCCACCTGATTATAAAATACCTTT
NATTAAACCCTTTTATTTCTCTCGCCTAAAAAAGCAGCTTCTANAAGCTGTGGA
Sequence Type genomic DNA
Unitrap ID UNI31582

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 26316587..26316959 365
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000054385 (Ceacam2) NM_007543 carcinoembryonic antigen-related cell adhesion molecule 2 Gene [Source:MGI Symbol;Acc:MGI:1347246]

 
Come back to gene ENSMUSG00000054385


For any suggestions or comments, please send an email to unitrap@crg.es