Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone CG0661
Clone ID CG0661
Vector pGT0lxrT2
Project sanger

Sequence tag CG0661
Sequence
CTCTCCCTTTTATGCTTTCTTTCCTCTCNTGCGTCGCACAGATGCCTATCAAGACGTGTCTATACATGGCACTCTTCCAC
GGAAGAAAAAGGGCCCTCCTTCCATACGGTCCTGTGACAATGCTGGCCACTCCAAATCCCCACGACAGAGCTCACCTCTG
ACCCAGGACATCATCCAGGAAAACCCACTGCAAGACCGGAAAGGGGAAAACTTCATCTTCAGGGATCCATATCTTCTGGA
CCCAACTCTGGAATACGTGAAGTTCTCCAAGGAGAGGCACATCATGGACAGGACCCCTGAGAGGCTGAAAAAGGAATTGG
AGGAGGAGCTGCTGCTGAGCAGCGAAGACCTACGCAGCCACGCCTGGTACCACGGCCGGATCCCCCGACAG
Sequence Type mRNA
Unitrap ID UNI1437

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 121560298..122207973 193
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000028121 (Bcar3) NM_013867 breast cancer anti-estrogen resistance 3 Gene [Source:MGI Symbol;Acc:MGI:1352501]

 
Come back to gene ENSMUSG00000028121


For any suggestions or comments, please send an email to unitrap@crg.es