Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST12292H11
Clone ID IST12292H11
Vector VICTR76
Project tigm

Sequence tag IST12292H11BBF1
Sequence
CCAGTAGCGGTTGTCCACCGGCAGGGACCGATAGCGTGCAGACGCCTACAAAGAGTTGCAGCAGGGTGGTGAAGTTTGAT
CCTCTGAGCGTTCCGTAGCTCGGTCGGGCAAGCGGCGTGTCCCACGTGCCGTTTCCGGTTACACTGGGACCCACGAGTCT
AAGCTGCCGCGGGGCCCGGGCTGCGACTGACAGAGGCGGACGTTTTCCAAGCACTGCTCGCCAGGGAGCCCACCCACAGC
CACCATGTCCGGCAGGAACAACAACAAGCTGCCCAGCAACCTGCCGCAGTTACAGAACCTGATCAAGCGGGACCCGCCGG
CCTACGTGGAGGAGGTGGGACCGGGATCT
Sequence Type genomic DNA
Unitrap ID UNI21770

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 92738804..92739151 348
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000029415 (Sdad1) NM_172713 SDA1 domain containing 1 Gene [Source:MGI Symbol;Acc:MGI:2140779]


Sequence tag IST12292H11HMF2
Sequence
CCCGAGTACCAGGCATTGGCACCTGCCTGCAAATGGAGCCATCTGTGGTCTGTGCCTTCACACCTAGGGAACATCTGTGC
CCACAGGTCAGCAGAAAGGGGGGTCCTCAGCCTGTTGCCAAGGACCAGAGTGTTCAAGGCAGGGGGAGGGTGGGAGTGAT
GTAACCACCTAAGCTTCCCTAGAGCAAACTCCTCCAGGACAGGTTCCTAGGAAGGCTGGAGGAGGGGCAGAGAAGCCAGA
GCCATCCCTCTTCCTGGATGGTGAGTCACTCTCTACTCTGCTAGGGCAAACAGCCCACAAGACTATGTCACCCATTGCCG
TTCTTGCTCTGGGCCCCCAAGGTACAGCAAGGACAAGGTAGACATGGGTCTGTAGTGGAGAGTCCTGGAAGAGTGTGTAG
AAGGGGCTTCTTAGAGGAAGANCCNTGTTAGTGGGGACAGGAAGTACATACAGCATGAGAAGAANGCTTANATCCCACAG
AGCTGTCTTTACCCCGAGCTNNGNNATTTACNNNGGATGGGGATGGGGCCACTGCATATTTCTNAGTCTN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 174088497..174089045 525
NO GENE  

 
Come back to gene ENSMUSG00000029415


For any suggestions or comments, please send an email to unitrap@crg.es