Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14543G8
Clone ID IST14543G8
Vector VICTR74
Project tigm

Sequence tag IST14543G8HMR1
Sequence
GGTAAATGTGTTATTGTTGAGGTTCAAGTTCTAGTCNCAGTACTTAATAGTAGTTCAATTATTCTGCCCGACGAACGTCT
TAACACTAACGCTGAGGCTTTTTCTCAGACCAAAGTGATGGGGGCTCACAAAACGATTTGCCGCTCAGAACCCGAACAGG
GTGCCTGCTGACTCAGGGGGAGGTATATATCAAGCCAGGAAGTTC
Sequence Type genomic DNA
Unitrap ID UNI16134

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 16: 84775694..84775897 202
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000053062 (Jam2) NM_023844 junction adhesion molecule 2 Gene [Source:MGI (curated);Acc:Jam2-001]


Sequence tag IST14543G8HMF1
Sequence
CCTCCCNANNGAAGAAACCAACAGAACAAAAGATAACAGGGAGGGGGAGGGTGTTTATCATCATCATCAACAACAACAAC
AACAACAACAACAAGGACTTCCTCACTTAAAAATAGATAGTAATTTCCTACCTTTTCCTAAAAAGTTC
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 16: 84775547..84775693 141
NO GENE  

 
Come back to gene ENSMUSG00000053062


For any suggestions or comments, please send an email to unitrap@crg.es