Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14423E7
Clone ID IST14423E7
Vector VICTR74
Project tigm

Sequence tag IST14423E7BBF1
Sequence
ATAGGGGGTCTTTGGGGGTGTTTGTTTGTTTGTTTGTTTGTTGTTTTATAAGAACCTCATTCACTTTGACAGCATGGAAA
TAAATGTCAGGTTTAGCCCACAAAGACACAAACACCAAGTATCGAGCTTGTGTATCTTTTTGAGCAGGTACCTTTGTCAT
CGCCACACAAGTAGCCTAGGAAGTGACTTTGATGTCTGTGTCACAGAATAGAAATGAGTGTCCANATGCTGTTGTTTTTN
ANNTTT
Sequence Type genomic DNA
Unitrap ID UNI23434

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 36664752..36664990 237
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000032118 (Fez1) NM_183171 fasciculation and elongation protein zeta 1 (zygin I) Gene [Source:MGI Symbol;Acc:MGI:2670976]


Sequence tag IST14423E7HMR1
Sequence
GTTCCNACAATGGGAACACCGAACCTCGGAATCTGAGCACAGAGCANCATGGCAGGAAACTATGCAGACAGCTTTCTGTA
ACAGGAGAAAAAGGAAATGAGTTCTCCTGCTTGCACAAAGTTC
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 114272892..114273013 118
NO GENE  


Sequence tag IST14423E7HMF2
Sequence
CTCCAAGTACAAGACAAGAGTCCTGTGGTCTCTGCTCCTTCACAGCATGGGGTTTTCTTGGAATGCGTTTTTGTGTTCTT
CCCAGGTGTAGGGGACAGGAGTGAATTTACTTCGACTGTTGTTATTAAGATTCCTCTATGGAAAAAAAAAAAAANNNTTT
TTTTT
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 114272683..114272846 156
NO GENE  

 
Come back to gene ENSMUSG00000032118


For any suggestions or comments, please send an email to unitrap@crg.es