Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST13062B2
Clone ID IST13062B2
Vector VICTR76
Project tigm

Sequence tag IST13062B2HMF1
Sequence
CCACCTACCGGGAGATCCCGATGGCCCTTGACCTCACCACTCTGGCTCCTAGGTACGAGGCAGCAAAATGAGCTGCCTCC
TGGCAGAACAGAATCGCGGCGAGTATTTCACCGTGTACAAGCCAAACATCGGCAGACAGAGCCAGCTGGAGACCCTGGAC
AGCCTGTGCCGGAAGTTTCACCGGGTAGGGAAGGCCCCACCCTCTCATGGCGTCTGGGGATGCACAGGGAGCTTCTGAGC
CTCTTCCCTGCTAACTTACTGTGTCCCCAGGTCACTGTGGAAGANGCCCGGGAACCCTGGGAGAGCAGCTATGCCCTGTC
CTTGGAGCACTGCAGTCACACCACCTGGTGAGGGGGAAGCCNCAAGGANGGCGGATCTGGGCGCCCAGTGTCCCAGGGCC
TTGTGGGCTGTGAAAGCNCAGGCTGTGAGCTGACCAGCAGTCCCCTGGTATANGAACCNNCGCTGCAGANTGACACNNNN
NGNCNAGTGCTGCGCCCAGGGCCTGCGCCNCCNCCNCCACTACATGCN
Sequence Type genomic DNA
Unitrap ID UNI31594

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 10: 79520818..79521344 491
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000035673 (Sbno2) NM_183426 strawberry notch homolog 2 (Drosophila) Gene [Source:MGI Symbol;Acc:MGI:2448490]

 
Come back to gene ENSMUSG00000035673


For any suggestions or comments, please send an email to unitrap@crg.es